- Clone
- AK4 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VI P-44
- Other Names
- GMP-140, PADGEM
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CCTTCCGTATCCCTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 304951 | 10 µg | 296€ | ||||
CD62P is a 140 kD type I transmembrane glycoprotein also known as P-selectin, platelet activation-dependent granule membrane protein (PADGEM), and GMP-140. It is expressed on activated platelets, megakaryocytes, and endothelial cells. CD62P is primarily stored in secretory α-granules in platelets and Weibel-Palade bodies in endothelial cells, and is rapidly relocated to the plasma membrane upon activation. The ligands for CD62P are CD162 and CD24. A primary function of CD62P is cell adhesion during neutrophil rolling, and platelet-neutrophil and platelet-monocyte interactions.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections4 and in vitro blocking of adhesion of platelets1. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 304947 & 304948).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Skinner M, et al. 1991. J. Biol. Chem. 266:5371. (Block)
- Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
- Yen YT, et al. 2006. J. Virol. 80:2684.
- Sato Y, et al. 2005. Blood 106:428. (IHC)
- RRID
-
AB_2892359 (BioLegend Cat. No. 304951)
Antigen Details
- Structure
- Selectin, type I glycoprotein, 140 kD
- Distribution
-
Activated platelets, megakaryocytes, endothelial cells
- Function
- Adhesion, neutrophil rolling, platelet-neutrophil and platelet-monocyte interactions
- Ligand/Receptor
- CD162 (PSGL-1), CD24 and sialylated Lewis X
- Cell Type
- Endothelial cells, Megakaryocytes, Neutrophils, Platelets
- Biology Area
- Cell Adhesion, Cell Biology, Immunology, Neuroscience, Synaptic Biology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. McEver R, et al. 1995. J. Biol. Chem. 270:11025.
2. Varki A. 1994. P. Natl. Acad. Sci. USA 91:7390. - Gene ID
- 6403 View all products for this Gene ID
- UniProt
- View information about CD62P on UniProt.org
Related FAQs
Other Formats
View All CD62P Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets stained ... -
FITC anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets stained ... -
PE anti-human CD62P (P-Selectin)
Thrombin-activated human platelets stained with AK4 PE -
PE/Cyanine5 anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets stained ... -
Purified anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets stained ... -
Biotin anti-human CD62P (P-Selectin)
Thrombin-activated human platelets stained with biotinylated... -
Alexa Fluor® 488 anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets stained ... -
Alexa Fluor® 647 anti-human CD62P (P-Selectin)
Thrombin-activated human platelets stained with AK4 Alexa Fl... -
Brilliant Violet 605™ anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
Brilliant Violet 421™ anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
PE/Cyanine7 anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
PerCP/Cyanine5.5 anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
Alexa Fluor® 700 anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
PE/Dazzle™ 594 anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
APC/Fire™ 750 anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
TotalSeq™-A0218 anti-human CD62P (P-Selectin)
-
Brilliant Violet 650™ anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
Brilliant Violet 510™ anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
Brilliant Violet 711™ anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
APC/Cyanine7 anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
Brilliant Violet 785™ anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets were sta... -
TotalSeq™-C0218 anti-human CD62P (P-Selectin)
-
Ultra-LEAF™ Purified anti-human CD62P (P-Selectin)
Thrombin-activated human peripheral blood platelets stained ... -
TotalSeq™-B0218 anti-human CD62P (P-Selectin) Antibody
-
TotalSeq™-D0218 anti-human CD62P (P-Selectin)
-
PE anti-human CD62P
Typical results from thrombin-activated human peripheral blo... -
FITC anti-human CD62P
Typical results from thrombin-activated human peripheral blo... -
GMP FITC anti-human CD62P (P-Selectin)
Typical results from thrombin-activated human peripheral blo... -
GMP PE anti-human CD62P (P-Selectin)
Typical results from thrombin-activated human peripheral blo...
Login / Register 



Follow Us