TotalSeq™-D0386 anti-human CD28 Antibody

Pricing & Availability
Clone
CD28.2 (See other available formats)
Regulatory Status
RUO
Workshop
V-CD28.05
Other Names
T44, Tp44
Isotype
Mouse IgG1, κ
Barcode Sequence
TGAGAACGACCCTAA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
302973 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD28 is a 44 kD disulfide-linked homodimeric type I glycoprotein. It is a member of the immunoglobulin superfamily and is also known as T44 or Tp44. CD28 is expressed on most T lineage cells, NK cell subsets, and plasma cells. CD28 binds both CD80 and CD86 using a highly conserved motif MYPPY in the CDR3-like loop. CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death. In vitro studies indicate that ligation of CD28 on T cells by CD80 and CD86 on antigen presenting cells provides a costimulatory signal required for T cell activation and proliferation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
Baboon, Capuchin Monkey, Chimpanzee, Pigtailed Macaque, Sooty Mangabey, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

 


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for highly sensitive assays.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Nunes J, et al. 1993. Biochem. J. 293:835.
  3. Calea-Lauri J, et al. 1999. J. Immunol. 163:62.
  4. Tazi A, et al. 1999. J. Immunol. 163:3511. (IHC)
  5. Marti F, et al. 2001. J. Immunol. 166:197. (Costim)
  6. Jeong SH, et al. 2004. J. Virol. 78:6995. (Costim)
  7. Rivollier A, et al. 2004. Blood 104:4029. (Costim)
  8. Scharschmidt E, et al. 2004. Mol. Cell Biol. 24:3860. (Costim)
  9. Sheng W, et al. 2007.Elsevier 580:6819. PubMed
  10. Mitsuhashi M. 2007. Clin Chem.53:148. PubMed
  11. Ye Z, et al. 2008. Infect. Immun. 76:2541. PubMed
  12. Magatti M, et al. 2008. Stem Cells 26:182. (FA) PubMed
  13. Yoshino N, et al. 2008. Exp. Anim. (Tokyo) 49:97. (FC)
  14. Berg M, et al. 2008. J Leukoc Biol. 83:853. (IP) PubMed
  15. Rout N, et al. 2010. PLoS One 5:e9787. (FC)
  16. Leonard JA, et al. 2011. J. Virol. 85:6867. PubMed
  17. Nomura T, et al. 2012. J. Virol. 86:6481. PubMed
RRID
AB_2910379 (BioLegend Cat. No. 302973)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, homodimer, 44 kD
Distribution

Mature T cells, thymocytes, NK cell subsets, plasma cells, EBV-positive B cells

Function
T cell costimulation
Ligand/Receptor
CD80, CD86
Cell Type
B cells, NK cells, Plasma cells, T cells, Thymocytes, Tregs
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
2. June CH, et al. 1994. Immunol. Today 15:321.
3. Linskey PS, et al. 1993. Annu. Rev. Immunol. 11:191.

Gene ID
940 View all products for this Gene ID
UniProt
View information about CD28 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD28 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD28 CD28.2 FC
Biotin anti-human CD28 CD28.2 FC
FITC anti-human CD28 CD28.2 FC
PE anti-human CD28 CD28.2 FC
PE/Cyanine5 anti-human CD28 CD28.2 FC
Purified anti-human CD28 CD28.2 FC,IHC-F,Costim,FA
Alexa Fluor® 488 anti-human CD28 CD28.2 FC
Alexa Fluor® 700 anti-human CD28 CD28.2 FC
PerCP/Cyanine5.5 anti-human CD28 CD28.2 FC
Pacific Blue™ anti-human CD28 CD28.2 FC
PE/Cyanine7 anti-human CD28 CD28.2 FC
Ultra-LEAF™ Purified anti-human CD28 CD28.2 FC,IHC-F,Costim,FA
Brilliant Violet 421™ anti-human CD28 CD28.2 FC
Brilliant Violet 510™ anti-human CD28 CD28.2 FC
Purified anti-human CD28 (Maxpar® Ready) CD28.2 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD28 CD28.2 FC
Brilliant Violet 785™ anti-human CD28 CD28.2 FC
Brilliant Violet 650™ anti-human CD28 CD28.2 FC
Brilliant Violet 711™ anti-human CD28 CD28.2 FC
APC/Fire™ 750 anti-human CD28 CD28.2 FC
Alexa Fluor® 647 anti-human CD28 CD28.2 FC
TotalSeq™-A0386 anti-human CD28 CD28.2 PG
TotalSeq™-B0386 anti-human CD28 CD28.2 PG
TotalSeq™-C0386 anti-human CD28 CD28.2 PG
Brilliant Violet 605™ anti-human CD28 CD28.2 FC
APC/Cyanine7 anti-human CD28 CD28.2 FC
PE anti-human CD28 CD28.2 FC
APC anti-human CD28 CD28.2 FC
Brilliant Violet 750™ anti-human CD28 CD28.2 FC
PE/Fire™ 810 anti-human CD28 CD28.2 FC
GMP PE anti-human CD28 CD28.2 FC
TotalSeq™-D0386 anti-human CD28 CD28.2 PG
Spark Violet™ 423 anti-human CD28 CD28.2 FC
GMP Ultra-LEAF™ Purified anti-human CD28 SF CD28.2 FC,Costim
GMP APC anti-human CD28 CD28.2 FC
PE/Cyanine7 anti-human CD28 CD28.2 FC
Cell-Vive™ GMP Ultra-LEAF™ Biotin anti-human CD28 SF CD28.2 FC,Activ
PerCP/Cyanine5.5 anti-human CD28 CD28.2 FC
Spark Blue™ 515 anti-human CD28 CD28.2 FC
Spark Red™ 718 anti-human CD28 CD28.2 FC
GMP PerCP/Cyanine5.5 anti-human CD28 CD28.2 FC
Pacific Blue™ anti-human CD28 CD28.2 FC
APC/Fire™ 810 anti-human CD28 CD28.2 FC
Go To Top Version: 1    Revision Date: 01/19/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account