- Clone
- 6-434 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VIII 80652
- Other Names
- Siglec7 (Sialic-binding Ig like lectin 7), p75, AIRM1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTTAGCATTTCACTG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 339221 | 10 µg | 296€ | ||||
Siglec-7, also known as p75/AIRM1, is a 75 kD type I transmembrane protein and a member of the family of sialic acid-binding immunoglobulin-like lectins (Siglecs). It is primarily found on NK cells and monocytes. The cytoplasmic domain of Siglec-7 contains immunoreceptor tyrosine-based inhibitory motif (ITIM). CD328 mediates sialic acid-dependent cell-cell binding and functions as an inhibitory receptor of NK cells. CD328 preferentially binds to sialylated glycans with α2,8 disialyl and α2,6 sialyl residues.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_3683357 (BioLegend Cat. No. 339221)
Antigen Details
- Structure
- Type I transmembrane protein, Siglec family member, 75 kD
- Distribution
-
NK cells, monocytes
- Function
- Inhibitory receptor of NK cells
- Ligand/Receptor
- Sialylated glycans (with α2,8 disialyl and α2,6 sialyl residues)
- Cell Type
- Monocytes, NK cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Siglec Molecules
- Antigen References
-
- Avril T, et al. 2006. Infection and Immunity 74:4133
- Avril T, et al. 2004. J. Immunol. 173:6841
- Yamaji T, et al. 2005. Glycobiology 15:667
- Gene ID
- 27036 View all products for this Gene ID
- UniProt
- View information about CD328 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD328 Reagents Request Custom Conjugation| Description | Clone | Applications |
|---|---|---|
| Purified anti-human CD328 (Siglec-7) | 6-434 | FC |
| PE anti-human CD328 (Siglec-7) | 6-434 | FC |
| APC anti-human CD328 (Siglec-7) | 6-434 | FC |
| Alexa Fluor® 700 anti-human CD328 (Siglec-7) | 6-434 | FC |
| PE/Cyanine7 anti-human CD328 (Siglec-7) | 6-434 | FC |
| TotalSeq™-C0902 anti-human CD328 (Siglec-7) | 6-434 | PG |
| APC/Fire™ 750 anti-human CD328 (Siglec-7) | 6-434 | FC |
| PerCP/Cyanine5.5 anti-human CD328 (Siglec-7) | 6-434 | FC |
| TotalSeq™-A0902 anti-human CD328 (Siglec-7) | 6-434 | PG |
| TotalSeq™-B0902 anti-human CD328 (Siglec-7) | 6-434 | PG |
| Spark Red™ 718 anti-human CD328 (Siglec-7) (Flexi-Fluor™) | 6-434 | FC |
| Spark Blue™ 574 anti-human CD328 (Siglec-7) (Flexi-Fluor™) | 6-434 | FC |
| Spark Blue™ 550 anti-human CD328 (Siglec-7) (Flexi-Fluor™) | 6-434 | FC |
| TotalSeq™-D0902 anti-human CD328 (Siglec-7) Antibody | 6-434 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD328 (Siglec-7)
-
PE anti-human CD328 (Siglec-7)
Human peripheral blood lymphocytes stained with 6-434 PE and... -
APC anti-human CD328 (Siglec-7)
Human peripheral blood lymphocytes were stained with CD56 PE...
-
Alexa Fluor® 700 anti-human CD328 (Siglec-7)
Human peripheral blood lymphocytes were stained with CD56 Br... -
PE/Cyanine7 anti-human CD328 (Siglec-7)
Human peripheral blood lymphocytes were stained with CD56 Br... -
TotalSeq™-C0902 anti-human CD328 (Siglec-7)
-
APC/Fire™ 750 anti-human CD328 (Siglec-7)
Human peripheral blood lymphocytes were stained with CD56 Br... -
PerCP/Cyanine5.5 anti-human CD328 (Siglec-7)
Human peripheral blood lymphocytes were stained with CD56 Br... -
TotalSeq™-A0902 anti-human CD328 (Siglec-7)
-
TotalSeq™-B0902 anti-human CD328 (Siglec-7)
-
Spark Red™ 718 anti-human CD328 (Siglec-7) (Flexi-Fluor™)
-
Spark Blue™ 574 anti-human CD328 (Siglec-7) (Flexi-Fluor™)
-
Spark Blue™ 550 anti-human CD328 (Siglec-7) (Flexi-Fluor™)
-
TotalSeq™-D0902 anti-human CD328 (Siglec-7) Antibody
Login / Register 



Follow Us