Formats

Discover Antibody-Oligo Formats

 

Each TotalSeq™ antibody is conjugated to a unique oligonucleotide containing a capture sequence, a clone-specific barcode sequence, and a PCR handle compatible with Illumina® sequencing reagents and instruments. Barcodes are placed between the PCR handle and 3’ flanking sequence. The oligonucleotide sequence that is conjugated to our TotalSeq™ antibodies is also referred to as an Antibody-Derived Tag, or ADT. The oligo sequence that is conjugated to our hashtag reagents is referred to as a Hashtag Oligonucleotide, or HTO.

 

For single-cell protein and RNA analysis, we offer TotalSeq™-A, -B, and –C formats and continue to work with compatible partners to support new versions of genomics reagents and solutions. 

Understand the Differences Between TotalSeq™ Formats

 

TotalSeq™-A: Contain a poly (A) capture sequence that mimics a natural mRNA. Designed to work with platforms that utilize poly (dT) oligonucleotides as the mRNA capture method. Compatible with 10x Genomics 3' Universal Gene Expression assay, captured via the poly (dT) sequence of the Gel Bead primers. Use of TotalSeq-A reagents with this assay requires reagent and protocol modifications; 10x Genomics provides only limited support for TotalSeq-A. For additional information regarding the use of TotalSeq-A reagents, please refer to our protocols or contact BioLegend Technical Support.

 

TotalSeq™-B: The capture sequence is compatible with the Capture Sequence 1, or Partial Capture Sequence 1 of the barcoded Gel Bead primers used with the 10x Genomics 3’ Universal Gene Expression or Flex Gene Expression assays, respectively. Use of TotalSeq-B antibodies with these assays is fully supported by 10x Genomics.

 

TotalSeq™-C: The capture sequence is compatible with the Template Switch Oligo Capture Sequence, or the Partial Capture Sequence 1 of the barcoded Gel Bead primers used with the 10x Genomics 5' Universal Gene Expression or Flex Gene Expression assays, respectively. The use of TotalSeq-C antibodies with these assays is fully supported by 10x Genomics.

 

For more information regarding compatibility of our TotalSeq products with partner solutions, such as 10x Genomics, please visit our Technology Partnerships and Service Providers page.

10x Genomics' Solutions, compatible with TotalSeq™-B and -C antibodies, contain all necessary reagents to process and amplify oligos derived from both TotalSeq™ reagents and mRNA. When using TotalSeq™-A reagents with the 10x Genomics' Single Cell 3' Universal Gene Expression assay, additional reagents for preparation of libraries must be purchased. Please refer to our protocols for a complete list.

 

  TotalSeq™-A TotalSeq™-B TotalSeq™-C
10x Genomics compatibility Chromium Single Cell Universal 3' Gene Expression assay and any system employing poly (A) tail capture method Chromium Single Cell Universal 3' Gene Expression and Flex Gene Expression assays Chromium Single Cell Universal 5' Gene Expression and Flex Gene Expression assays
PCR handle CCTTGGCACCCGAGAATTCCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN2 CGGAGATGTGTATAAGAGACAGNNNNNNNNNN
Capture sequence Poly-A [(A)30*A*A3] NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A4 NNNNNNNNNCCCATATAAGA*A*A4
Next-generation sequencing compatibility Compatible with Illumina instruments Compatible with Illumina instruments Compatible with Illumina instruments

 

Notes:

  1. N represents a randomly selected A, C, G, or T.
  2. The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.
  3. These sequences are unique to the TotalSeq™-B and -C conjugates, and were developed independently of the reagents used by researchers at the New York Genome Center (NYGC, CITE-seq.com). TotalSeq™-B, -C, and the antibodies used by NYGC are all compatible with 10x Genomics' Solutions, but utilize different oligo sequences. As such, protocols and additional reagents, including required primers, differ between the antibody formats. Please refer to our protocols when using TotalSeq™ reagents.
ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account